Foro del olivar
Para poder formular una pregunta, como para responderla es necesario registrarse.

Si tienes algún problema para registrarte, conectarte o para entrar en el foro ponte en contacto conmigo en este email: forodelolivar@gmail.com

cosecha 2016-17

Página 6 de 13. Precedente  1, 2, 3 ... 5, 6, 7 ... 11, 12, 13  Siguiente

Ver el tema anterior Ver el tema siguiente Ir abajo

cosecha 2016-17

Mensaje  Querty el Lun Abr 18, 2016 5:07 pm

Recuerdo del primer mensaje :

Aquí dejo una herramienta para vislumbrar por donde puede ir la campaña 16/17


Podéis descargar el archivo o abrirlo y editarlo en el siguiente enlace
http://bit.ly/producción_aceite_últimas_4_campañas

Como podréis comprobar dado el carácter alternante de la producción del olivo cuando en una campaña el aceite obtenido es mayor que la media en una provincia, generalmente la siguiente campaña el aceite obtenido será menor que esta media y será tanto menor cuanto más cosecha haya habido.

Por ejemplo en el caso de Badajoz  si su media de producción es 40.000 tn, este año han producido
60.000 tn por lo que el año próximo con toda probabilidad la producción va a quedar muy por debajo de las 40.000 tn.

La misma reflexión pero en sentido contrario se puede hacer con las provincias que han producido este año menos aceite que su media. Un saludo.

_________________
http://bit.ly/el_foro_al_dia

Querty


Volver arriba Ir abajo


Re: cosecha 2016-17

Mensaje  rafanavarro@live.com el Lun Jul 25, 2016 1:01 am

anlo escribió:

Estos olivos ya puse un vídeo el pasado año de ellos, al final salieron a algo mas de 150 kgr con un rendimiento del 28%, pues este año aunque parezca increíble han vuelto a cargar y lo mejor de todo las crecidas que han metido para el próximo año, espectaculares, están podados de este año y les di pero que bien, pues ya veis, se han vuelto a cerrar.
Labores hechas en esta parcela, primeramente después de la recolección un abonado de fondo nitrogenado del 26 a relación de 5 kgr por árbol, una buena poda y triturado de los restos, un sulfato con productos de saco grande muyyyy completo y un pase de cultivador por las calles.

Por consejo de Andrés (Anlo), voy a intervenir en este hilo.

Esta finca del vídeo, tenía este aspecto en Septiembre de 2015, ya después de unos 80 litros de lluvia:







Yo estaba junto a Andrés mientras tomaba fotos con el móvil.

Con el manejo hecho desde septiembre hasta el momento de este vídeo, se ha conseguido superar el estado nutritivo deficiente de los nutrientes relacionados con la exportación de fotoasimilados a la aceituna, potasio sobre todo.


En el otoño estos olivos presentaban una cosecha bastante alta, de en torno a 150 kg por árbol, en una finca con poco estrés hídrico estival, por lo que la aceituna tenía muy buen tamaño, e iba a seguir demandando gran cantidad de nutrientes hasta la recolección, con el consiguiente riesgo de grave erosión en las reservas minerales del olivo.

En octubre se aplicó un tratamiento foliar personalizado, aportando un cóctel de nutrientes adecuado al estado nutritivo, carga y suelo de la finca: 70 kg de N, P, K y B + cobre + aminoácidos, a una cuba de 2000 litros. 

Estos olivos se trataron a pistola, aplicando un buen volumen de caldo por olivo, como lo atestiguaban las fotos que siguió poniendo Andrés durante el otoño, invierno y principios de primavera, en las que aún se veía perfectamente el cobre del tratamiento foliar de octubre.


Después de la recolección, se ha seguido con la poda, el abonado nitrogenado al suelo, el tratamiento foliar de abril, manejo de malas hierbas y laboreo parcial. Ni que decir, que este año, la precipitación en el año agrícola ha superado en esa zona los 600 litros.

En estos momentos, los olivos han conseguido cuajar una cosecha poco menor que la del año anterior, y es patente la mejoría en el estatus nutritivo: la hoja es larga, verde, plana, los entrenudos largos, y existen importantes crecimientos vegetativos delante de la aceituna.

Espero que sea de interés esta información.

Un saludo.

rafanavarro@live.com

Localización : Córdoba

Volver arriba Ir abajo

Re: cosecha 2016-17

Mensaje  anlo el Lun Jul 25, 2016 6:29 am

Gracias Rafa por tu intervención, has explicado perfectamente todo paso a paso, eres un fenómeno  gracias de nuevo y un saludo.

anlo

Localización : santisteban del puerto Jaen

Volver arriba Ir abajo

Re: cosecha 2016-17

Mensaje  anlo el Lun Jul 25, 2016 6:34 am

Y la verdad por delante, decir que gracias a ti he conseguido tener una cosecha bastante buena después de otra que aunque no como ésta fue también media alta. Esto por lo pronto es lo que hay, todavía queda mucho verano pero cierto es que ahora mismo da alegría ver los olivos el verdor y lo frescos que aún se mantienen.

anlo

Localización : santisteban del puerto Jaen

Volver arriba Ir abajo

Re: cosecha 2016-17

Mensaje  arbequinopicantillo el Lun Jul 25, 2016 9:47 pm

Anlo , esos olivos no los vibras con vibró de tractor , verdad?

arbequinopicantillo

Localización : Jaen

Volver arriba Ir abajo

Re: cosecha 2016-17

Mensaje  anlo el Lun Jul 25, 2016 10:34 pm

Pues no, no es muy de mi agrado ese cacharrejo Very Happy Very Happy Very Happy , por?????????????????

anlo

Localización : santisteban del puerto Jaen

Volver arriba Ir abajo

Re: cosecha 2016-17

Mensaje  anlo el Dom Jul 31, 2016 11:38 am

Yo sigo a lo mio, y como me gusta ilustrar mis comentarios con fotos si es posible pues ayer hice otras pocas de unas parcelas que estuve desvaretando.
Esta en cuestión viene precedida de una cosecha muy grande, y este año han vuelto a cargar. Decir que mucho mérito

(y es que tengo que decirlo) se debe a nuestro particular biólogo del foro. Pues repertir dos buenas cosechas seguidas no es muy normal. Por ejemplo, despues de la de hace tres años, al año siguiente solo tuvieron un pintorreo. Ya el año pasado volvieron a cargar y este han vuelto otra vez a hacerlo.








anlo

Localización : santisteban del puerto Jaen

Volver arriba Ir abajo

Re: cosecha 2016-17

Mensaje  anlo el Dom Jul 31, 2016 11:40 am

Tambien se pueden observar las buenas crecidas que tienen para el próximo año, que es otro reto mas superado, pues lo normal es que se hubiera quedado el tallo corto despues de dos cosechas, y al contrario, mucha aceituna es dificil de ver pues esta totalmente tapada por ñlas crecidas de los tallos.

anlo

Localización : santisteban del puerto Jaen

Volver arriba Ir abajo

Re: cosecha 2016-17

Mensaje  anlo el Dom Jul 31, 2016 11:52 am

Algunas de las cosas que nos limita la cosecha y que se a hablado mucho de ello en el foro esel manejo del suelo y la poda, super impotantes las dos cosas si no queremos quedarnos sin cosecha y a verlas venir.
La prueba aquí la teneis, dos parcelas de la misma edad los olivos, con el mismo terreno y con la diferencia que los del vecino tienen algo de riego de apoyo y los mios son de secano total. Pues ahora vereis que diferencia de olivos. El motivo de esta diferencia, pues que desde el otoño la parcela parecia un sembrao y se a mantenido toda esta broza hasta hace muy poquito que le pasaron la desbrozadora, le lavaron la cara pero era demasiado tarde, el daó estaba echo, ys desde la primavera se notaba que los olivos no venían igual( eso para que me digan que la hierba en invierno y primavera hasta que no dice de secarse no compite con el olivar).
Después les realizaron una poda muy agresiva para unos olivos jóvenes que no se lo merecían ni mucho menos, el resultado será que cuando pase el verano tendrán muchas de sus ramas negras por el sol, y perdida de cosecha al dejar el olivo muy limitado en cuanto a la relación hoja madera. Están muy pelados y sin nada de retallo, lo cual pronostica que no solo este año tienen poca cosecha ,sino que el siguiente tampoco será muy bueno salvo un milagro.












anlo

Localización : santisteban del puerto Jaen

Volver arriba Ir abajo

Re: cosecha 2016-17

Mensaje  Endrinales el Dom Jul 31, 2016 5:37 pm

El aceite bajando por culpa de Anlo

A ver si poniendo fotos de los míos sube el precio








¿A qué no sabéis lo que les falta? Y no se vale decir monóxido de dihidrógeno

Saludos

Endrinales


Volver arriba Ir abajo

Re: cosecha 2016-17

Mensaje  juan jesus el Dom Jul 31, 2016 7:11 pm

AAAAAAGGGGGGGGGGUUUUUUAAAAAA¡¡¡¡¡¡¡
por un tubo

juan jesus


Volver arriba Ir abajo

Re: cosecha 2016-17

Mensaje  rafanavarro@live.com el Dom Jul 31, 2016 9:55 pm

osoloco escribió:
¿A qué no sabéis lo que les falta? Y no se vale decir monóxido de dihidrógeno

Saludos

Osoloco, los bellos de punta y las lágrimas saltadas!!! Laughing Laughing Laughing

En los tiempos del Sálvame y Hombres, Mujeres y Viceversa, qué dificil es leer estas cosillas!!!

Osoloco, las fotos que pones, no son una excepción a la media que hay en Andalucía este año. Hay muchas zonas así o peor, tanto de Picual como de Hojiblanco.

A ver dónde están las 1.5 millones de toneladas.

Un saludo.

rafanavarro@live.com

Localización : Córdoba

Volver arriba Ir abajo

Re: cosecha 2016-17

Mensaje  rafanavarro@live.com el Dom Jul 31, 2016 10:06 pm

Respondo a la información que ha puesto Andrés Anlo.

Estos olivos de secano están en una vegueta de un arroyo, con un suelo aluvial muy profundo, franco arenoso, que no le supone ninguna limitación ni de agua, ni de oxígeno ni de apenas nutrientes.

El año pasado salieron justitos de aceituna, a 150 kg / árbol... 

Uno de esos olivos ha sido la foto de perfil de Andrés durante un tiempo. 

Si bien son espectaculares de aspecto, tienen el defecto del excesivo vigor dado por el terreno, por lo que llegan a agarrar más aceituna de la que pueden desarrollar convenientemente. Además, como no paran de crecer en todo el verano, hay mucho ramón compitiendo con la aceituna, que se suele quedar pequeña, aunque fresca.

Esto se suele traducir en cosechas de menor rendimiento graso a la media de la zona, y alta vecería.

Gracias al manejo, se ha solucionado la vecería. Con lo que tenían colgando el año pasado, se les dió en otoño un tratamiento normal fuerte, pero poco después, se le repitió con materia orgánica + fósforo + potasio, para favorecer el proceso de maduración. 

Se buscaba ablandar la aceituna, que se queda muy dura en fincas así, a la vez que intentar mantener los niveles de nutrientes sin que cayesen a niveles preocupantes.

Con la aceituna ya mas blanda, se pudo no trepar mucho retallo, y engañar al olivo, al haberle echo que la aceituna estuviera madura antes, con lo que se incidió positivamente en la cosecha de retorno.


Esto es sólo una mínima actuación en la finca. El resto del año, el sr. Anlo está con la desbrozadora, motosierra y hachuela, haciendo lo que casi no hace nadie hoy en día. 

Estos olivos llevan esta primavera, una cantidad hermosa de Nitrosulfato amónico 26 % y un tratamiento foliar en abril.

Un saludo.

rafanavarro@live.com

Localización : Córdoba

Volver arriba Ir abajo

Re: cosecha 2016-17

Mensaje  arbequinopicantillo el Lun Ago 01, 2016 4:52 pm

Un dia despues de colgar Osoloco fotos de sus olivos  el poolred ha pegado un repunte . Very Happy Very Happy

arbequinopicantillo

Localización : Jaen

Volver arriba Ir abajo

Re: cosecha 2016-17

Mensaje  el Conde de Montecristo el Lun Ago 01, 2016 5:10 pm

anlo escribió:Algunas de las cosas que nos limita la cosecha y que se a hablado mucho de ello en el foro esel manejo del suelo y la poda, super impotantes las dos cosas si no queremos quedarnos sin cosecha y a verlas venir.
La prueba aquí la teneis, dos parcelas de la misma edad los olivos, con el mismo terreno y con la diferencia que los del vecino tienen algo de riego de apoyo y los mios son de secano total. Pues ahora vereis que diferencia de olivos. El motivo de esta diferencia, pues que desde el otoño la parcela parecia un sembrao y se a mantenido toda esta broza hasta hace muy poquito que le pasaron la desbrozadora, le lavaron la cara pero era demasiado tarde, el daó estaba echo, ys desde la primavera se notaba que los olivos no venían igual( eso para que me digan que la hierba en invierno y primavera hasta que no dice de secarse no compite con el olivar).
Después les realizaron una poda muy agresiva para unos olivos jóvenes que no se lo merecían ni mucho menos, el resultado será que cuando pase el verano tendrán muchas de sus ramas negras por el sol, y perdida de cosecha al dejar el olivo muy limitado en cuanto a la relación hoja madera. Están muy pelados y sin nada de retallo, lo cual pronostica que no solo este año tienen poca cosecha ,sino que el siguiente tampoco será muy bueno salvo un milagro.

 
    Viendo las fotos del olivar de Anlo y los olivos de su vecino, no me cabe duda de que el principal factor limitante no es el suelo, los sulfatos, ni siquiera el agua, pues NO, el principal factor limitante es el propietario de los olivos.
    El propietario y los cuidados culturales prestados son la clave para tener un olivar bonito y productivo. Por el contrario, teniendo buen suelo, una pluviometria no baja, convertirlo en un olivar marginal.
    No sabemos nada de sulfatos aplicados y otras labores, pero la poda del vecino es de juzgado de guardia, y ahí, seguro, empieza la historia..
    Un saludo

el Conde de Montecristo

Localización : Corduva

Volver arriba Ir abajo

Re: cosecha 2016-17

Mensaje  anlo el Lun Ago 01, 2016 6:22 pm

Conde, respecto a tu comentario te puedo decir hasta donde yo se. De sulfatos a dado por lo menos dos que yo haya visto, lo que no se es lo que habría dentro de la Cuba del todoterreno.La poda como tú dices no es nada agraciada, pero yo estoy seguro que a estos olivos se los a cargado la hierba. Llevan ya dos años así, comidos de hierba todo Tajo parejo, no curó la hierba en otoño porque ya el pasado año no tuvieron tampoco aceituna, los estaba rebuscando en abril cuando yo estaba podando los mios y la pica aceituna que había estaba enredada entre la hierba que la mayoría allí se quedó.Ahi a seguido la hierba verde hasta que casi a últimos de mayo acudió a curar la hierba, que llegaba a la rodilla y más dura que un canto. El daño estaba echo, los olivos desde la carretera se veían los hilos suyos con color amarillo y todos los demás más verdes que las ovas. Se me a pasado decir que fue cogerlas las podo y a estado los restos de poda hasta junio liados con la hierba que ni se veían ya, en fin un desastre . Y los olivos que tiene me los arreglo yo en una semana

anlo

Localización : santisteban del puerto Jaen

Volver arriba Ir abajo

Re: cosecha 2016-17

Mensaje  Ming el Lun Ago 01, 2016 8:10 pm

anlo escribió:Conde, respecto a tu comentario te puedo decir hasta donde yo se. De sulfatos a dado por lo menos dos que yo haya visto, lo que no se es lo que habría dentro de la Cuba del todoterreno.La poda como tú dices no es nada agraciada, pero yo estoy seguro que a estos olivos se los a cargado la hierba. Llevan ya dos años así, comidos de hierba todo Tajo parejo, no curó la hierba en otoño porque ya el pasado año no tuvieron tampoco aceituna, los estaba rebuscando en abril cuando yo estaba podando los mios y la pica aceituna que había estaba enredada entre la hierba que la mayoría allí se quedó.Ahi a seguido la hierba verde hasta que casi a últimos de mayo acudió a curar la hierba, que llegaba a la rodilla y más dura que un canto. El daño estaba echo, los olivos desde la carretera se veían los hilos suyos con color amarillo y todos los demás más verdes que las ovas. Se me a pasado decir que fue cogerlas las podo y a estado los restos de poda hasta junio liados con la hierba que ni se veían ya, en fin un desastre . Y los olivos que tiene me los arreglo yo en una semana
Espero que a tu lindero le sirva de experiencia. Por aquí las grandes fincas han seguido un manejo similar al de tu vecino y están igual de feas. También hay algunos pequeños que han descansado de trabajar en la primavera y ahora están pasando calor con la desbrozadora para encima no coger ni una aceituna. Yo, aunque me ha costado trabajo, he conseguido llegar al verano con los suelos más o menos limpios (salvo algunas zonas infectadas de vallico).

Ming


Volver arriba Ir abajo

Re: cosecha 2016-17

Mensaje  rafanavarro@live.com el Lun Ago 01, 2016 9:02 pm

el Conde de Montecristo escribió:

    Viendo las fotos del olivar de Anlo y los olivos de su vecino, no me cabe duda de que el principal factor limitante no es el suelo, los sulfatos, ni siquiera el agua, pues NO, el principal factor limitante es el propietario de los olivos.

Conde, se me han saltado las lágrimas, la de veces que lo he dicho para mis adentros todos estos años!!! Laughing Laughing Laughing Laughing

rafanavarro@live.com

Localización : Córdoba

Volver arriba Ir abajo

Re: cosecha 2016-17

Mensaje  juan jesus el Mar Ago 02, 2016 12:49 am

Conde mañana intentaré colgar unas fotos de unos olivos con hierba seca y verde, aunque estén feos verlos pero a la vez veréis como están de aceituna. Por lo que en mi opinión la hierba puede influir, pero no limitar una cosecha.
Es mi humilde opinión.

juan jesus


Volver arriba Ir abajo

Re: cosecha 2016-17

Mensaje  anlo el Mar Ago 02, 2016 12:43 pm

Todos los terrenos no son iguales, yo te aseguro que en el caso que he expuesto ha sido la causa. Y no soy novato en el tema. Un saludo.

anlo

Localización : santisteban del puerto Jaen

Volver arriba Ir abajo

Re: cosecha 2016-17

Mensaje  rafanavarro@live.com el Mar Ago 02, 2016 1:36 pm

La hierba donde más daño puede hacer es en no laboreo de secano, donde las raíces del olivo están muy superficiales, y tienen que competir directamente con las raíces de la hierba. Y la hierba, debemos de recordar, que está formada por plantas anuales con una única función en la vida, producir el máximo número de semillas posible en su ciclo anual, lo que consiguencon una estrategia de absorción de agua y nutrientes del suelo muy agresiva, tan agresiva, que supera a la capacidad del olivo.

En otras situaciones, como un laboreo, podría aguantarse la hierba algo más de tiempo, ya que la capa superior del suelo, que en laboreo, no deja de ser realmente una cubierta, está exenta de raíces del olivo, por lo que, mientras que las raíces de la hierba no bajen mucho por debajo de la capa arada, tampoco habría más incidencia.

En un riego por goteo, si la mayoría de raíces activas del olivo, están alrededor de los bulbos húmedos, tampoco se nota demasiado la hierba que haya por las calles. Y la hierba de los bulbos, haría daño, pero si el agua profundiza, puede escapar al alcance de gran parte de las raíces de la hierba, pero no del olivo. Otra cosa serían los nutrientes.

Nunca nada es blanco o negro, ni se puede generalizar. 

Un saludo.

rafanavarro@live.com

Localización : Córdoba

Volver arriba Ir abajo

Re: cosecha 2016-17

Mensaje  camino60 el Mar Ago 02, 2016 2:09 pm

Juan Jesus,donde únicamente no influye la hierba es el el riego,en todo lo demás ya sea laboreo o no laboreo siempre hace mucho daño,compite en nutrientes y en humedad,ahora Rafa lo ha dicho no todo es blanco o negro,si tiene humedad de sobra y nutrientes también pues hay para la hierba y el olivo.

camino60

Localización : Granada

Volver arriba Ir abajo

Re: cosecha 2016-17

Mensaje  Endrinales el Mar Ago 02, 2016 7:39 pm

arbequinopicantillo escribió:Un dia despues de colgar Osoloco fotos de sus olivos  el poolred ha pegado un repunte . Very Happy Very Happy
Bueno, ese era el objetivo Laughing Laughing Laughing

Rafa Navarro, parece que a tí también te da grima telecinco. La verdad es que la sociedad está cambiando, y pensar que los que tienen que cotizar para que nosotros cobremos se dedican a cazar pokemons es para echarse a llorar

Endrinales


Volver arriba Ir abajo

Re: cosecha 2016-17

Mensaje  Endrinales el Mar Ago 02, 2016 8:03 pm

camino60 escribió:Juan Jesus,donde únicamente no influye la hierba es el el riego,en todo lo demás ya sea laboreo o no laboreo siempre hace mucho daño,compite en nutrientes y en humedad,ahora Rafa lo ha dicho no todo es blanco o negro,si tiene humedad de sobra y nutrientes también pues hay para la hierba y el olivo.

La verdad es que esto de la hierba es para hacer un tratado a parte. La hierba tiene beneficios sobre el suelo del olivar (aumenta la materia orgánica, aumenta la actividad microbiana, mejora la estructura del suelo,disminuye la erosión...), y si mejora el suelo mejora el olivar. pero también tiene perjuicios ("secuestra" los nutrientes, consumen agua, atraen a los conejos, algunas hierbas pueden segregar sustancias perjudiciales para el olivar, peligro de incendio...)

Yo estoy a favor de la hierba, pero la clave es saber gestionarla, y para eso deberíamos saber en marzo cuando y cuanto va a llover en abril y mayo, y eso es imposible.

Pienso que debería de haber un listado sobre que hierbas pueden ser más beneficiosas para el olivar y cuales más perjudiciales, para eliminar estas ultimas y favorecer el aumento de las primeras.

Saludos

Endrinales


Volver arriba Ir abajo

Re: cosecha 2016-17

Mensaje  rusafa el Sáb Ago 06, 2016 11:58 pm

Algunas de las imágenes que pongo más adelante, creo que las he puesto en otros comentarios, como estamos en estos días muy pendientes del estrés que está padeciendo el olivo, pongo este comentario en este tema con imágenes que corresponden a otro.

Los años son cada vez más cortos de agua, gota que caiga, hay que intentar retenerla de la manera que sea, es sólo una opinión.

Imágenes de pozas, una vez hechas, sólo necesitan algo de mantenimiento. Avenida de agua que viene de otros vecinos. Mis olivos la mayoría con pozas, tanto por la parte de arriba como por abajo, poca agua se puede perder.











Se trata de pozas encauzadas una detrás de otra regando cada uno de los olivos y zonas restantes, como curiosidad, desde que terminé de hacerlas, las pozas de los últimos olivos todavía no se han estrenado.

El olivo que pongo, esta en esa zona, en el tema de la poda he puesto imágenes, y realicé algún comentario con respecto a la muestra que traía para el tiempo que era.











Creo que comenté que estaba obligando a tirar aceituna a ese olivo, podría haber cortado solamente la rama pequeña del centro, pero tiré la gorda, con la idea también de que el sol y el aire disminuyan en algo  las verrugas.

Las próximas imágenes,  pueden mostrar que este olivo si puede tener síntomas de estar podrido, por el aspecto que presenta el tronco.





Las  siguientes imágenes han sido tomadas este domingo pasado, revisando riegos, no creo que le achaquéis el aspecto que muestra el olivo por el riego, una vez a la semana de 7am a 19 pm, dos goteros de 8 litros, dos cartas de pago a 2 euros más la que quedan. Si, el riego es un apoyo para mantener un poco la situación.







Rafa, en  la última conversación que hemos tenido con los cortes de arroje, en esta oliva se ve la fuerza que llevan, espero (todavía no he empezado con la limpieza de cabezas) que la euzofera respete a esos brotes, pero con estas calores,  más de una lagartija que tienen cada uno de los pies y el resto de depredadores que tenga, por no utilizar insecticida nada más que en casos puntuales, no haya mucha incidencia en los cortes como sucedió el año pasado.

Las olivas de esta parcela fueron las primeras en realizarle la corta, seguro que se llevan más de un mes con respecto a las de secano.

Otro comentario sobre los cortes, es que normalmente se aprovecha los años buenos de agua para cortar esas costeras pasadas en años y en madera, para aprovechar la fuerza  del olivo y así  ir  renovando, cada zona es distinta.

En otras ocasiones se atusa mucho el corte que apenas lo dejamos sin yemas para poder arrojar  el corte en condiciones.

Las varetas podrían llegar a la cabeza si no la hubiese cortado con la desbrozadora cuando terminé de repasar la hierba.

Imágenes del olivo y de la aceituna, por el aspecto que presenta nada indica que el pie puede estar podrido, se trata de otra variedad distinta a picual.











Cuando la oliva está bien cala, ya puede venir el verano que quiera.

Saludos.

rusafa

Localización : jaen

Volver arriba Ir abajo

Re: cosecha 2016-17

Mensaje  rafanavarro@live.com el Dom Ago 07, 2016 12:22 am

De esos olivos se ven algunos por Jaén, pero no se (ni nadie a quien le pregunto) qué variedad es.

¿Sabes cómo se llama?

Un saludo.

rafanavarro@live.com

Localización : Córdoba

Volver arriba Ir abajo

Re: cosecha 2016-17

Mensaje  Contenido patrocinado Hoy a las 3:54 am


Contenido patrocinado


Volver arriba Ir abajo

Página 6 de 13. Precedente  1, 2, 3 ... 5, 6, 7 ... 11, 12, 13  Siguiente

Ver el tema anterior Ver el tema siguiente Volver arriba

- Temas similares

 
Permisos de este foro:
No puedes responder a temas en este foro.